negative control on-targetplus non-targeting control pool  (Thermo Fisher)

Journal: Molecular Systems Biology

Article Title: Strong negative feedback from Erk to Raf confers robustness to MAPK signalling

doi: 10.1038/msb.2011.27

Figure Lengend Snippet: Robustness of MAPK signalling. ( A ) Mathematical analysis of Erk phosphorylation kinetics suggests that the phospho-Erk level depends linearly on Erk protein concentration (green line, no robustness). The red line shows hypothetical partial robustness, where phosho-Erk level depends sublinearly on Erk. The blue line corresponds to a fully robust system, where phosho-Erk can fully compensate loss of Erk. ( B ) The consequences of variability in Erk expression (grey) on phospo-Erk expression for a non-robust, partially robust and fully robust system are shown. ( C ) Steady-state phospho-Erk level of LIM1215 cells depends only weakly on Erk concentration. Each dot shows quantified pan-isoform phospho-Erk and Erk levels from western blots of cells treated with siRNA against Erk1 or Erk2 alone, Erk1 and Erk2 in combination in percent of the scrambled control. ( D ) Possible mechanisms providing robustness illustrated for knockdown of Erk2: competition for upstream kinase Mek, where loss of Erk2 results in higher access of Erk1 to Mek; post-translational negative feedback, where loss of Erk2 results in relieve of negative feedback and therefore stronger upstream signalling; and transcriptional negative feedback, where knockdown of Erk2 results in decreased concentrations of deactivating phosphatases. Source data is available for this figure at www.nature.com/msb .

Article Snippet: Cells were either mock-transfected, scrambled-transfected (ON-TARGETplus Non-targeting Pool negative control siRNA with at least four mismatches to any human, mouse or rat gene; Thermo Scientific Dharmacon) or transfected with 50 nM Erk1 (siRNA pool using the following sequences from Invitrogen: MAPK3HSS108538 GGAAGCCAUGAGAGAUGUCUACAUU, AAUGUAGACAUCUCUCAUGGCUUCC; MAPK3HSS108539 GCAUUCUGGCUGAGAUGCUCUCUAA, UUAGAGAGCAUCUCAGCCAGAAUGC; MAPK3HSS108540 CCUGCUGGACCGGAUGUUAACCUUU, AAAGGUUAACAUCCGGUCCAGCAGG), Erk2 (MAPK1HSS1085535 GCCGAAGCACCAUUCAAGUUCGACA, UGUCGAACUUGAAUGGUGCUUCGGC; MAPK1HSS1085536 UCACACAGGGUUCCUGACAGAAUAU, AUAUUCUGUCAGGAACCCUGUGUGA; MAPK1HSS1085537 GGGCUACACCAAGUCCAUUGAUAUU, AAUAUCAAUGGACUUGGUGUAGCCC) siRNA or both for Erk1/2 knockdown, further using lipofectamine 2000 or RNAi-Max (both from Invitrogen) according to the manufacturer's instructions.

Techniques: Phospho-proteomics, Protein Concentration, Expressing, Concentration Assay, Western Blot, Control, Knockdown

Journal: Molecular Systems Biology

Article Title: Strong negative feedback from Erk to Raf confers robustness to MAPK signalling

doi: 10.1038/msb.2011.27

Figure Lengend Snippet: Detailed analysis of post-translational compensation of varying Erk concentration. ( A ) Position of mutations of the analysed cells in the pathway: five colon carcinoma cell lines were analysed, LIM1215 has no mutation in the MAPK signalling pathway, HT29 and RKO express constitutively active B-Raf (V600E), and SW480 and HCT116 harbour an activating mutation in K-Ras. ( B ) Changes in expression of Erk1 (left) and Erk2 (right) 48 h after treating the cells with scrambled control siRNA or siRNA targeting Erk1, Erk2 or both isoforms in the five cell lines. If one isoform is knocked down, no significant change in the other isoform can be observed. ( C ) Pan-isoform Erk and phospho-Erk levels after knockdown of Erk1 and/or Erk2 were calculated as fraction of the unperturbed scrambled controls. Cells with B-Raf mutation show a linear relation between Erk concentration and phospho-Erk level that is predicted by a mathematical model for a system without feedback (shown as line). Cells with B-Raf wild type show strong robustness in phospho-Erk level corresponding to response coefficients of 0.36 and 0.20 for HCT116 and SW480, respectively. ( D ) Representative western blot images of knockdown experiments in SW480 and HT29. ( E ) Changes in Mek phosphorylation 48 h after treating the cells with scrambled control siRNA or siRNA against Erk1, Erk2 or both isoforms. While B-Raf wild-type cells show a strong increase in phospho-Mek, B-Raf-mutated cells (HT29 and RKO) show no change in phospho-Mek after knockdown. Source data is available for this figure at www.nature.com/msb .

Article Snippet: Cells were either mock-transfected, scrambled-transfected (ON-TARGETplus Non-targeting Pool negative control siRNA with at least four mismatches to any human, mouse or rat gene; Thermo Scientific Dharmacon) or transfected with 50 nM Erk1 (siRNA pool using the following sequences from Invitrogen: MAPK3HSS108538 GGAAGCCAUGAGAGAUGUCUACAUU, AAUGUAGACAUCUCUCAUGGCUUCC; MAPK3HSS108539 GCAUUCUGGCUGAGAUGCUCUCUAA, UUAGAGAGCAUCUCAGCCAGAAUGC; MAPK3HSS108540 CCUGCUGGACCGGAUGUUAACCUUU, AAAGGUUAACAUCCGGUCCAGCAGG), Erk2 (MAPK1HSS1085535 GCCGAAGCACCAUUCAAGUUCGACA, UGUCGAACUUGAAUGGUGCUUCGGC; MAPK1HSS1085536 UCACACAGGGUUCCUGACAGAAUAU, AUAUUCUGUCAGGAACCCUGUGUGA; MAPK1HSS1085537 GGGCUACACCAAGUCCAUUGAUAUU, AAUAUCAAUGGACUUGGUGUAGCCC) siRNA or both for Erk1/2 knockdown, further using lipofectamine 2000 or RNAi-Max (both from Invitrogen) according to the manufacturer's instructions.

Techniques: Concentration Assay, Mutagenesis, Expressing, Control, Knockdown, Western Blot, Phospho-proteomics